• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    ISOLATED SEQUENCE, ISOLATED NUCLEOTIDE SEQUENCE, GENETIC CONSTRUCTION, EXPRESSION VECTORS, PAAVCAG-co-hu-SFMD AND PLASMID paAV-hAAT-co-hu-SFMD VECTORS, PHARMACEUTICAL COMPOSITION AND METHOD FOR ITS MANUFACTURING, METHOD FOR PRODUCTION EXPRESSION, ISOLATED CELL, AND METHOD FOR THE TREATMENT OF TYPE IIIA MUCOPOLYSACCHARIDOSIS The present invention provides new sequences, genetic constructs, vectors and pharmaceutical compositions for the treatment of diseases and especially for the treatment of mucopolysaccharidosis.
    公开号:BR112012031067B1
    申请号:R112012031067-4
    申请日:2011-06-10
    公开日:2021-05-04
    发明作者:Fátima Bosch Tubert；Éduard Ayuso López；Albert Ruzo Matias
    申请人:Universidad Autonoma De Barcelona；Esteve Pharmaceuticals, S.A；
    IPC主号:
    专利说明:

    [0001] The present invention relates to vectors useful for the expression of proteins of interest and their use in gene therapy. The present invention also relates to vectors and nucleic acid sequences useful for the treatment of mucopolysaccharidoses (MPS) and especially for the treatment of type III mucopolysaccharidoses or Sanfilippo's syndrome. BACKGROUND OF THE INVENTION
    [0002] The lysosome is an organelle based on the cytoplasm of eukaryotic cells, which serves as a depot for many hydrolytic enzymes and as a center for decomposition and recycling of cellular components. This organelle contains several types of hydrolytic enzymes, including proteases, nucleases, glycosidases, lipases, phospholipases, phosphatases and sulfatases. All enzymes are acid hydrolases.
    [0003] Lysosomal storage diseases (LSDs) are caused by genetic deficiencies that affect one or more lysosomal enzymes. These genetic disorders generally result from a deficiency in a specific enzyme activity present in the lysosome. To a lesser degree, these diseases may be due to protein deficiencies involved in lysosomal biogenesis.
    [0004] LSDs are individually rare, although as a group these disorders are relatively common in the general population. The combined prevalence of LSDs is approximately 1 per 5,000 live births. See Meikle P, et al, JAMA 1999; 281: 249 - 254. However, some groups among the general population are particularly hard hit by a high occurrence of LSDs. For example, the prevalence rates of Gaucher and Tay-Sachs diseases in Jewish descendants from Central and Eastern Europe (Ashkenazi) are 1 in every 600 and 1 in every 3,900 births, respectively. The Finnish population is also affected by an extremely high prevalence rate of LSDs.
    [0005] Type III mucopolysaccharidoses (MPSIII), known collectively as Sanfilippo syndrome, are LSDs caused by a deficiency in one of the enzymes involved in the degradation of heparan sulfate, which leads to its pathological accumulation. MPSIII are classified into four subtypes, depending on enzyme deficiency. The loss of sulfamidase activity leads to subtype IIIA, having been referred to as the most severe, the one that manifests earlier and with the lowest survival rate. MPSIIIA symptoms occur in the first years of life and are characterized by severe neurodegeneration, which leads to profound mental retardation, aggressiveness, hyperactivity and sleep disorders. Patients progressively lose the ability to speak, swallow and motor coordination. In addition to neurological symptoms, patients with MPSIIIA suffer from non-neurological disorders, including hepatomegaly and splenomegaly, skeletal and joint malformations, as well as frequent diarrhea and airway infections. The progressive worsening of symptoms results in the patient's death during adolescence. See Neufeld E, Muenzer J, "The mucopolysaccharidoses" in Scriver C, et al., Eds., "The metabolic and molecular basis of inherited disease" (McGraw-Hill Publishing Co., New York, NY, US, 2001, pp 3421 - 3452).
    [0006] Currently there is no cure for MPSIIIA; therefore, existing treatments aim to control the symptoms of the disease and improve the poor quality of life of patients. MPS-associated disorders can be treated by bone marrow transplantation or enzyme replacement therapy (ERT). Both approaches are based on the endocytosis of lysosomal enzymes from the extracellular environment and their targeting to the lysosomes via the mannose-6-phosphate receptor (M6PR), present in the cell membrane. However, bone marrow transplantation has been shown to be ineffective in treating patients with MPSIII. See Sivakamur P, Wraith J, J. Inherit. Metab. Dis. 1999; 22: 849 - 850. ERT has been shown to be effective in counteracting non-neurological accumulation in other lysosomal storage diseases, including MPSI, II and VI. See Harmatz P, et al., J. Mol. Genet. Metab. 2008; 94: 469 - 475; Muenzer J, et al., Genet. Med. 2006; 8: 465 - 473 and Wraith J, et al., J. Pediatr. 2004; 144: 581 - 588. In addition to the high cost of these treatments, it has been shown that ERT does not result in the correction or preservation of neuronal function, due to insufficient release of the exogenously produced enzyme across the blood-brain barrier (BBB). See Enns G, Huhn S, Neurosurg. Focus 2008; 24: E12. More recently it has been shown that high dose ERT is partially successful in clearing CNS deposits of MPS VII, possibly due to saturation of M6PR and mannose receptors, which lead to a longer half-life of circulating protein. . See Vogler C, et al, Proc. Natl. Academic Sci. USA 2005; 102: 14777 - 14782. This study demonstrates that elevated levels of circulating enzyme for long periods of time are related to better correction of the pathology. Intracerebral and intracerebrospinal fluid release of the enzyme also proved effective in reducing CNS pathology in mice with MPS IIIA. See Hemsley K, et al, Genes Brain Behav. 2008; 53(2): 161-8 and Savas P, et al., Mol. Genet. Metab. 2004; 82: 273 - 285. However, this method is highly invasive, due to the need for several repeated injections, and it may increase the risk of brain damage and/or infections.
    [0007] Given the limitations of current therapeutic options for MPSIII, alternative approaches are needed. Gene transfer could be the means of obtaining permanent production of the missing enzyme, from a single intervention. Adeno-associated vectors (AAV) are rapidly emerging as the vector of choice for many genetic therapeutic applications, due to their high transduction efficiency and lack of pathogenicity. AAV vectors efficiently translate postmitotic cells and several preclinical and clinical studies have demonstrated the potential of AAV vector-mediated gene transfer to effectively drive the delayed release of therapeutic tangents for a variety of diseases. See Daya S, Berns K, Clin. Microbiol. Rev. 2008; 21: 583 - 593.
    [0008] It has been shown that the administration of an AAV5 vector that jointly releases sulfamidase and the sulfatase activator SUMF1 in the lateral ventricles of a newborn mouse with MPSIIIA can correct many neurological and behavioral changes. See Fraldi A, et al, Hum. Mol. Genet. 2007; 16: 2693 - 2702. However, this proposed evolution of action has several shortcomings. First, the CMV promoter used was reported to silence. Second, the long-term effects of co-release of sulfamidase and SUMF1 have not yet been evaluated. It is unclear whether joint release of SUMF is necessary and whether it provides any additional permanent benefits compared to treatment with sulfamidase alone. Thirdly, AAV5 vectors have a low distribution within the parenchyma and, more importantly, the release of sulfamidase in the brain using these vectors does not result in any transduction of brain tissue, so following this approach , no correction of the somatic phenotype is achieved. Finally, Fraldi, 2007, supra, demonstrated the effectiveness of gene transfer only in newborn mice with MPSIIIA. There are no references to experiments with older mice. Since MPSIIIA is usually diagnosed from 3 - 4 years of age, the newborn animal model is not adequate to predict the effects of this treatment in humans.
    [0009] Taking into account the difficulties of diagnosing MPSIIIA at birth, the development of therapeutic interventions starting in early adulthood has been proposed. It was reported that intravenous administration of a lentiviral sulfamidase expression vector in adult mice resulted in a slight improvement in the CNS phenotype, probably due to the relatively poor transduction performance of these vectors in vivo. See McIntyre C, et al, Mol. Genet. Metab. 2008; 93: 411 - 418. Thus, the use of viral vectors with greater in vivo transduction efficiency, such as AAV vectors, may provide higher levels of circulating sulfamidase, which could potentially improve or correct the neurological pathology.
    [00010] The treatment of MPSIIIA via gene therapy requires more efficient vectors and coding sequences of sulfamidase. Therefore, there has long been a need for an effective treatment of MPSIIIA. There is also a need for new approaches to the treatment of this disease that would enhance the safety features. MPSIIIA is a rare disease and is therefore an 'orphan disease'. Drugs specifically developed to treat this rare medical condition will thus be 'orphan drugs'.
    [00011] SUMMARY OF THE INVENTION
    [00012] The present invention provides a new nucleotide sequence for the treatment of diseases, preferably for the treatment of mucopolysaccharidoses (MPS). Therefore, the first aspect of the invention relates to a nucleotide sequence that is a human sulfamidase codon optimized sequence, which allows the transcription of a more stable mRNA. This sequence is transcribed at higher rates and therefore produces higher yields of the sulfamidase enzyme. The sequence has a better expression profile and is therapeutically more effective than other methods of codon optimization of the sulfamidase nucleotide sequence. This increase in enzyme expression levels is followed by an increase in sulfamidase activity in the serum, which allows for a reduction in the accumulation of the disease-causing glycosaminoglycan (GAG). Said sequence is SEQ ID NO: 1, or a sequence with at least 85% identity with the sequence SEQ ID NO: 1, which codes for the protein SEQ ID NO: 2.
    [00013] In a second aspect, the invention relates to a genetic construct that includes the nucleotide sequence of the first aspect of the invention.
    [00014] The present invention also provides new AAV vectors, serotype 9, capable of crossing the blood-brain barrier (BHE), and has more tropism for different brain structures. This allows sulfamidase activity to specifically increase in the brain, reducing the accumulation of GAG and therefore improving the neurological symptoms of MPS. Serotype 9 of the AAV vectors also exhibits unexpectedly high tropism to heart, pancreas and muscle tissue, thus enhancing the overall therapeutic benefits of the invention.
    [00015] For example, after administration of AAV vectors of serotypes 8 and 9 (AAV8 and AAV9) in adult mice with MPSIIIA, by intravenous (iv) injection directed to the liver, by intramuscular (im) injection directed to skeletal musculature, or intracisternally (ic) directed to the central nervous system, the levels of expression of sulfamidase reached with the im application of the vector were not therapeutic levels. Intracisternal administration managed not only to increase the level of circulating sulfamidase, but also to reverse the MPSIIIA somatic phenotype in several types of tissues, including the brain. The liver-targeted approach was able to produce high levels of circulating sulfamidase activity, which surprisingly corrected the global somatic accumulation phenotype of MPSIIIA and significantly the neuropathology associated with the disease. These results provide evidence of the efficacy of sulfamidase AAV-mediated gene transfer in adult mice with MPSIIIA, a disease model that closely resembles the human clinical setting. The inventors were able to completely correct both the somatic and neurological changes of MPSIIIA.
    [00016] The genetic constructs of the present invention may further include suitable promoters, such as CAG or hAAT promoters, to control and enhance the expression of sulfamidase. For example, the CAG promoter is more stable than the CMV promoter and is therefore more likely to induce sulfamidase expression for longer periods of time. On the other hand, the safety and efficacy of the hAAT promoter makes it an ideal vehicle for the delivery of follow-up or maintenance doses of sulfamidase. Controlling the expression of SEQ ID NO: 1 by the CAG or hAAT promoters has significantly potentiated its therapeutic effects.
    [00017] Also the AAV vectors of the present invention stimulate the activity of sulfamidase, which reduces the accumulation of GAG and improves the clinical outcome in individuals suffering from MPS. A single administration may suffice because the sulfamidase promoter and nucleotide sequence, located between the inverted terminal repeats (ITR), are incorporated into the genome of the individual's cells. Therefore, a single parenteral administration is sufficient to obtain a long-term effect.
    [00018] In a third aspect, the invention relates to a pharmaceutical composition that includes a nucleotide sequence of the first aspect of the invention, the gene construct, or the expression vector of the invention.
    [00019] In a fourth aspect, the invention relates to the nucleotide sequence, the gene construct, the expression vector, or the pharmaceutical composition of the invention, for use as a medicine. The medicine can be used to increase the activity of sulfamidase in the body, for enzyme replacement therapy, for gene therapy, or for a treatment of MPS.
    [00020] In a fifth aspect, the invention relates to a method for producing the expression vectors of the first and second aspects of the invention.
    [00021] In a sixth aspect, the invention relates to a method for manufacturing the pharmaceutical compositions of the third aspect of the invention.
    [00022] In a seventh aspect, the invention relates to a method for treating an individual with mucopolysaccharidosis type IIIA with the first, second and third aspects of the invention. The present invention also relates to the use of a nucleotide sequence, the genetic construct, the expression vector, or the pharmaceutical compositions of the invention, in the manufacture of a medicine to increase sulfamidase activity in the body, for replacement therapy enzymatic, gene therapy, or the treatment of mucopolysaccharidoses, or type IIIA mucopolysaccharidosis.
    [00023] Figure 1. Intramuscular administration of AAV1-CAG-mu-SFMD-WPRE. (A) Sulfamidase activity in skeletal musculature of treated MPS control mice. (B) Sulfamidase activity in the serum of treated MPS control mice. (C) Quantification of glycosaminoglycan (GAG) in the liver of treated MPS control mice. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, #P < 0.05 vs. males, * P < 0.05 vs. Untreated MPS. ND: not detected.
    [00024] Figure 2. Intramuscular application of AAV8-CAG-mu-SFMD-WPRE. (A) Sulfamidase activity in skeletal muscle of treated MPS control mice. (B) Sulfamidase activity in the serum of treated MPS control mice. (C) Quantification of glycosaminoglycan (GAG) in the liver of treated MPS control mice. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, #P < 0.05 vs. males, * P < 0.05 vs. Untreated MPS. ND: not detected.
    [00025] Figure 3. Intravenous application of AAV8-CAG-mu-SFMD-WPRE. (A) Sulfamidase activity in the liver of treated MPS control mice. (B) Sulfamidase activity in the serum of treated MPS control mice. (C) Quantification of glycosaminoglycan (GAG) in the liver of treated MPS control mice. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, #P < 0.05 vs. males, * P < 0.05 vs. Untreated MPS. ND: not detected.
    [00026] Figure 4. Intravenous application of AAV8-hAAT-mu-SFMD. (A) Sulfamidase activity in the liver of treated MPS control mice. (B) Sulfamidase activity in the serum of treated MPS control mice. (C) Quantification of glycosaminoglycan (GAG) in the liver of treated MPS control mice. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, #P < 0.05 vs. males, * P < 0.05 vs. Untreated MPS. ND: not detected.
    [00027] Figure 5. Improvement of neurological pathology in mice with MPSIIIA after intravenous administration of AAV8-hAAT-mu-SFMD. (A) Sulfamidase activity in different parts of the control brain (specified in the diagram) of males with MPS and treated males. (B) Quantification of glycosaminoglycan (GAG) in the same parts of the brain. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, * P < 0.05 vs. untreated. ND: not detected. (C) Transmission electron microscopy of Purkinje cells in the cerebellum. The Purkinje neuron bodies of untreated MPSIIIA mice were filled with many large electron high density inclusions (white arrows), whereas in males treated with AAV8-hAAT by i.v. route fewer and smaller inclusions (black arrows) were found.
    [00028] Figure 6. Intravenous AAV9-CAG-mu-SFMD. (A) Sulfamidase activity in different parts of the brain (specified in the diagram) of the treated MPS control mice. (B) Quantification of glycosaminoglycan (GAG) in the same parts of the brain. (C) Motor function evaluation by the Rotarod acceleration test. Values are the means ± SEM of 4 to 8 mice per group. ¥ P < 0.05 vs. control, * P < 0.05 vs. Untreated MPS.
    [00029] Figure 7. Cerebral transduction after intracisternal administration of adeno-associated viral serotypes 1, 2, 5, 7, 8 and 9 GFP vectors. A dose of 5 x 1010 vector genomes of the appropriate vector was administered intracisternally to 2 month old animals, which were sacrificed and analyzed 2 weeks later. Adeno-associated virus serotype 9 demonstrated the highest transduction efficiency in all areas analyzed. The syringe indicates the route of administration of the vector, the cisterna magna. P: Pox pons, Cb: cerebellum, OB: olfactory bulb, Ht: hypothalamus, Cx: cerebral cortex.
    [00030] Figure 8. Intracisternal administration of AAV9-CAG-mu-SFMD vectors. Quantification of glycosaminoglycan (GAG) in the different parts of the brain (specified in the diagram) of the MPS-treated control mice. Values are the means ± SEM of 3 mice per group. ¥ P < 0.05 vs. control, * P < 0.05 vs. Untreated MPS.
    [00031] Figure 9. Intravenous administration of AAV9-CAG-hu-co-SFMD. Sulfamidase activity in liver of MPS control mice treated with either AAV9-CAG-mu-SFMD (non-optimized gene) or AAV9-CAG-hu-co-SFMD (optimized gene).
    [00032] Figure 10. Reduction of lysosomal pathology in perineuronal glial cells of the occipital cortex. Transmission electron microscopy specifies the cortical neurons of the occipital cortex and their associated glial cells. The lysosomal pathology of MPSIIIA was much more evident in perineuronal glial cells than in neurons. The presence of large electroluminous vacuoles is shown in the glial cells of samples from untreated males with MPSIIIA (white arrows, upper right panel) and not in WT samples (upper left panel). This increase in the lysosomal compartment was greatly reduced in mice treated with AAV8hAAT i.v., and most of the perineuronal glial cells in these samples looked similar to that of the WTs (bottom panels). (1) neuron, (2) perineuronal glial cell.
    [00033] Figure 11. Survival of males and females treated with intravenous AAV8-hAAT-SFMD. (A) Kaplan-Meier survival analysis in males treated with intravenous WT, MPSIIIA and AAV8-hAAT-SFMD. AAV-mediated gene therapy, directed to the liver, considerably prolonged the lifespan of animals with MPSIIIA (p < 0.001). (B) Kaplan-Meier survival analysis in females treated with WT, MPSIIIA and AAV8-hAAT-SFMD iv AAV-mediated gene therapy, targeting the liver, did not prolong the lifespan of females with MPSIIIA (p = 0.467) .
    [00034] Figure 12. Survival of males and females treated with intracisternal and intravenous AAV9-CAG-mu-SFMD. Kaplan-Meier survival analysis in males (A) and females (B) treated with WT, MPSIIIA and AAV9. Gene therapy, both intracisternal and AAV-mediated intravenous, prolonged the life span of animals with MPSIIIA.
    [00035] Figure 13. Intrascisternal administration of AAV9 vectors in dogs led to transduction of disseminated areas of the CNS and liver. Immunohistochemical detection of GFP in the CNS and liver sections of a dog injected with AAV9-GFP through the cisterna magna. The images correspond to: (a) spinal cord, (b) medulla oblongata bulbar olive, (c) raphe nuclei from the Varolian bridge, (d) hypothalamus nuclei (e) rhinencephalon (f) occipital cortex, (h) frontal cortex, (i) cerebellum, (j) dentate hippocampal fascia. Bar scale: 1mm for (a), 500 µm for (b) - (h), 100 µm for (i) - (j).
    [00036] Figure 14. Liver transduction after intracisternal administration of AAV9-GFP vector in healthy Beagle dogs. Immunohistochemical detection of GFP in liver sections counterstained with hematoxylin. Representative images of Dog 1 (A) and Dog 2 (B) are shown. Original 200X magnification.
    [00037] Figure 15. Serum sulfamidase activity and liver GAG content in animals injected with AAV9-co-hu-SFMD i.v. (A) Serum sulfamidase activity, measured with fluorogenic substrate. (B) Hepatic GAG accumulation 2 months after vector administration.
    [00038] DEPOSIT OF MICRO-ORGANISMS
    [00039] Plasmid pAAV-CAG-co-hu-SFMD was deposited on May 16, 2011, under accession number DSM 24817, at DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen, Inhoffenstrasse 7B, D38124 Braunschweig, Federal Republic from Germany.
    [00040] Plasmid pAAV-CAG-mu-SFMD was deposited on May 16, 2011, under accession number DSM 24818, at DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen, Inhoffenstrafte 7B, D38124 Braunschweig, Federal Republic of Germany .
    [00041] Plasmid pGG2-hAAT-mu-SFMD was deposited on May 16, 2011, under accession number DSM 24819, at DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen, Inhoffenstrafte 7B, D38124 Braunschweig, Federal Republic of Germany . DEFINITIONS
    [00042] The term "nucleotide sequence" refers to a nucleic acid molecule, both DNA and RNA, that contains deoxyribonucleotides or ribonucleotides. Nucleic acid can be double-stranded, single-stranded, or contain portions of both a double-stranded and single-stranded sequence.
    [00043] The term "% sequence identity" refers to the percentage of nucleotides of a candidate sequence that are identical to the nucleotides of SEQ ID NO: 1, after sequence alignment, to achieve maximum % sequence identity . The % sequence identity can be determined by any methods or algorithms established in the prior art, such as the ALIGN, BLAST and BLAST 2.0 algorithms. See Altschul S, et al., Nuc. Acids Res. 1977; 25: 3389 - 3402 and Altschul S, et al., J. Mol. Biol. nineteen ninety; 215: 403 - 410.
    [00044] In this case, the % sequence identity is calculated by dividing the number of identical nucleotides, after aligning SEQ ID NO: 1 and the candidate sequence, by the total number of nucleotides of SEQ ID NO: 1 and multiplying the result by 100 .
    [00045] The term "encode" refers to the genetic code that determines how a nucleotide sequence becomes a polypeptide or a protein. The order of nucleotides in a sequence determines the order of amino acids along a polypeptide or protein.
    [00046] The term "protein" refers to a linear chain of amino acids or a polypeptide that is folded into a globular shape. Proteins can undergo post-transformation modifications, such as the conversion of a cysteine residue to 3-oxoalanine, glycosylation or metal bonding. The glycosylation of a protein is the addition of different carbohydrates that are covalently joined together in the amino acid chain.
    [00047] The term "effective dose" refers to the amount of a substance that is sufficient to achieve the intended effect. For example, an effective dose of an expression vector to increase sulfamidase activity is an amount sufficient to reduce glycosaminoglycan accumulation. A "therapeutically effective dose" of an expression vector to treat a disease or disorder is that amount of the expression vector that is sufficient to reduce or remove the symptoms of that disease or disorder. The effective dose of a given substance will vary depending on factors such as the nature of the substance, the route of administration, the size and species of the animal to which that substance is to be administered and the purpose of administering the substance. The effective dose for each individual case can be determined empirically by a skilled person, according to methods established in the art.
    [00048] The term "individual" refers to an arbitrary animal, preferably a human or non-human mammal, more preferably a mouse, a rat, other rodents, a rabbit, a dog, a cat, a pig, a cow , a horse or a primate, or even more preferably a man.
    [00049] The term "operably linked" refers to the functional relationship and location of the promoter sequence to the gene of interest (e.g., a promoter or enhancer is operably linked to a coding sequence if transcription of the sequence is affected). Generally, an operably linked promoter is contiguous with the sequence of interest. However, an enhancer does not have to be contiguous with the sequence of interest to control its expression.
    [00050] The term "tropism" refers to the pathway in which different viruses have evolved, preferentially targeting specific host species, or specific types of cells within those species.
    [00051] The term "genetic therapy" refers to the transfer of the genetic material of interest (eg DNA or RNA) into a host, to treat or prevent a genetic or acquired disease or disorder. The genetic material of interest encodes a product (e.g., a polypeptide of a protein, a functional peptide or RNA) that is intended to be produced in vivo. For example, the genetic material of interest can encode an enzyme, hormone, receptor, or polypeptide of therapeutic value.
    [00052] The term "CAG promoter" refers to the combination formed by the cytomegalovirus premature enhancer element and the chicken β-actin promoter (i.e. SEQ ID NO: 3). See Alexopoulou A, et al, BMC Cell Biology 2008; 9(2): 1 - 11.
    [00053] The term "hATT promoter" refers to the human alpha1-antitrypsin promoter (i.e. SEQ ID NO: 4). See Hafenrichter H, et al, Blood 1994; 84: 3394 - 3404.
    [00054] The term "viral vector particle" refers to the genetically modified virus used to deliver genes to the organism. The viral vector particles carry the viral genome. The viral genome includes the nucleotide sequence located between the ITRs (Inverted Terminal Repeats) in the expression vector used for the production of viral vector particles. The adeno-associated particles of the viral vector are called AAV. The term "AAV vector" refers to the adeno-associated particles of the viral vector. DETAILED DESCRIPTION OF THE INVENTION
    [00055] In a preferred embodiment, the sequence of the first aspect of the invention has at least 85% sequence identity to SEQ ID NO: 1, which codes for protein SEQ ID NO: 2. Preferably, sequence identity is at least 87%. Most preferably, the sequence identity is at least 90%. Most preferably, the sequence identity is at least 95%. Even more preferably, the sequence identity is at least 98%. The most preferred is that the sequence identity be at least 99%. In a more preferred embodiment, the sequence of the first aspect of the invention is the nucleotide sequence SEQ ID NO: 1. In another embodiment, the invention relates to a nucleotide sequence SEQ ID NO: 1 or a biologically active variant of this sequence . A biologically active variant includes a molecule that has the same biological activity as SEQ ID NO: 1 and at least 85% sequence identity. Biological activity refers to the fact that the nucleotide sequence SEQ ID NO: 1 can be transcribed into a messenger RNA which has increased its stability and therefore has high translation rates, which allows for high level expression of active human sulfamidase.
    [00056] In a preferred embodiment of the second aspect, the gene construct comprises a nucleotide sequence with at least 85%, preferably 87%, 90%, 95%, 98%, 99% sequence identity for SEQ ID NO: 1. In a more preferred embodiment, the gene construct comprises the nucleotide sequence SEQ ID NO: 1. A gene construct is a nucleic acid molecule, in which the different elements have been designed in a specific and desired manner. These elements can be, among others, replication sequences, control sequences, coding sequences, multiclonal sequences or recombination sequences. In a preferred embodiment, the gene construct is a vector. A vector is a nucleic acid molecule used to transfer genetic material into a cell. In addition to said genetic material, a vector can also contain different functional elements, which include control elements for transcription, such as promoters or operators, transcription factor linking regions or enhancers, and control elements for translation initiation or termination. Vectors include, but are not limited to: plasmids, cosmids, viruses, phages, recombinant expression cassettes and transposons. Adeno-associated vectors (AAV) are the particles of viral vectors and are therefore not a nucleic acid molecule, but a genetically modified virus used to deliver genes to an organism.
    [00057] In a preferred embodiment of the second aspect of the invention, the gene construct is a vector that is used for the translation and transcription of a gene of interest, usually controlled by a promoter. A promoter is a nucleotide sequence that controls translation of the gene of interest. The promoter is operably linked to the gene of interest.
    [00058] Another preferred vector is an adeno-associated vector. In a preferred embodiment, the adeno-associated vector is used to produce adeno-associated particles, where the serotype is 1, 2, 5, 7, 8, or 9. In a more preferred embodiment, the serotype is 9. An adeno-associated vector is a vector derived from the genome of an adeno-associated virus (AAV) of the Parvoviridae family. The AAV genome is constructed from single-stranded deoxyribonucleic acid (ssDNA). AAVs infect man, but are non-pathogenic (i.e. they do not cause the disease). They can infect both divisible and non-dividable cells, as well as their tropism changes, depending on the serotype. Serotype is the classification of viruses into groups based on their capsid antigens. The AAV serotype, determined by its capsid proteins, defines viral tropism and allows its entry into a specific cell type. The production of adeno-associated vector particles is described below.
    [00059] In a first preferred embodiment of the second aspect, the expression vector comprises the CAG promoter operably linked to SEQ ID NO: 1.
    [00060] A preferred vector is an expression vector, comprising the CAG promoter, the promoter sequence being SEQ ID NO: 3. Thus, an embodiment of the second aspect of the invention is an expression vector comprising the CAG promoter, being the promoter sequence SEQ ID NO: 3, suitable for treating MPS.
    [00061] In a second preferred embodiment of the second aspect, the expression vector comprises the hepatospecific hAAT promoter, operably linked to SEQ ID NO: 1.
    [00062] A preferred vector is the expression vector comprising the hepatospecific promoter hAAT, the promoter sequence being SEQ ID NO: 4. Therefore, a preferred embodiment of the second aspect of the invention is an expression vector comprising the hepatospecific promoter hAAT, the promoter sequence SEQ ID NO: 4 being suitable for treating MPS.
    [00063] Another aspect of the present invention relates to a viral vector particle, also called an expression vector, which carries the nucleotide sequences of the first aspect of the invention, or the gene construct or the expression vector of the second aspect. of the invention.
    [00064] A preferred expression vector has serotype 1, 2, 5, 7, 8 or 9. A more preferred viral vector particle has serotype 9.
    [00065] A preferential expression vector has serotype 9 and comprises a viral genome comprising a CAG promoter operably linked to SEQ ID NO: 1.
    [00066] A preferential expression vector has serotype 8 or 9 and comprises a viral genome comprising an hAAT promoter operably linked to SEQ ID NO: 1.
    [00067] A preferential expression vector has serotype 9 and comprises a viral genome comprising the hAAT promoter operably linked to SEQ ID NO: 1.
    [00068] In a preferred embodiment, the expression vector is AAV-CAG-co-hu-SFMD and more preferably AAV9-CAG-co-hu-SFMD.
    [00069] In yet another preferred embodiment, the expression vector is AAV-hAAT-co-hu-SFMD, and more preferably, AAV8-hAAT-co-hu-SFMD or pAAV9-hAAT-co-hu-SFMD. The most preferred vector used, when the hAAT promoter is used, is AAV9-hAAT-co-hu-SFMD.
    [00070] In a preferred embodiment of the third aspect, the pharmaceutical composition is administered parenterally. Parenteral administration refers to the route of administration of a pharmaceutical composition in the form of injection or infusion. Examples of parenteral administration are intravenous, subcutaneous, intrasternal and intramuscular injections. The pharmaceutical composition is preferably administered intravenously or intracisternally.
    [00071] In another preferred embodiment, the pharmaceutical composition comprises a therapeutically effective dose of the nucleotide sequence, the gene construct, the viral vector particle or expression vector of the invention.
    [00072] In a preferred embodiment of the fourth aspect, the nucleotide sequence, the gene construct, the expression vector, the viral vector particle, or the pharmaceutical composition of the invention are used as a medicine. In a preferred embodiment, they are used to increase sulfamidase activity in the body.
    [00073] In another preferred embodiment, the nucleotide sequence, the gene construct, the expression vector, the viral vector particle, or the pharmaceutical composition of the invention are used as a medicine for enzyme replacement therapy or gene replacement therapy , preferably gene therapy. The inventors propose a new approach to gene therapy for the treatment of MPSIIIA, which is more effective than others already known in the prior art. This approach is based on AAV vectors that express sulfamidase. Enzyme replacement therapy (ERT) is a medical treatment that consists of replacing an enzyme in patients in whom a particular enzyme is deficient or non-existent. The enzyme is usually produced as a recombinant protein that is administered to the patient.
    [00074] In another embodiment, the nucleotide sequence, the gene construct, the expression vector, the viral vector particles, or the pharmaceutical composition of the invention are preferably used for the treatment of mucopolysaccharidoses, more preferably of mucopolysaccharidosis of the type III, or Sanfilippo syndrome, preferably through gene therapy. Within the scope of type III mucopolysaccharidosis syndrome, subtype A is especially amenable to treatment with the present invention.
    [00075] In a preferred embodiment of the fifth aspect, a method for producing the expression vectors of the invention is claimed. The process comprises the phases of:
    [00076] Providing a first vector comprising SEQ ID NO: 1 interposed between a first AAV terminal repeat and a second AAV terminal repeat, a CAG or hAAT promoter operably linked to SEQ ID NO: 1; a second vector, comprising an AAV rep gene and an AAV cap gene; and a third vector, comprising the gene with adenovirus help function;
    [00077] Co-transfection competent cells with phase i) vectors;
    [00078] Culture of stage ii transfection cells); and
    [00079] Purification of expression vectors from culture phase iii).
    [00080] In a preferred embodiment, the first and second AAV terminal repeats of the first vector are AAV serotype 2 ITRs. In another preferred embodiment, the AAV rep genes of the second vector are from AAV serotype 2. In yet another preferred embodiment, the AAV cap genes from the second vector are from AAV serotypes 1, 2, 5, 7, 8 or 9. More preferably, the AAV cap genes from the second vector are from AAV serotype 9 . In another preferred embodiment, the competent cells are HEK293 cells.
    [00081] Viral vectors are administered in sufficient amounts for the transfection of cells and to provide sufficient levels of gene transfer and expression in order to provide therapeutic benefit without excessive side effects, or with physiological effects acceptable in light of medical criteria, and which can be determined by experts in medical science.
    [00082] In a preferred embodiment of the sixth aspect, a method for manufacturing the pharmaceutical compositions of the invention is claimed. This method comprises combining any of the nucleotide sequences, gene constructs, viral vector particles or expression vectors of the invention, as well as a pharmaceutically acceptable vehicle or carrier, so as to facilitate administration to produce the compositions of the invention. The carrier is, for example, water, or a buffered saline solution, with or without a preservative. Pharmaceutical compositions can be lyophilized for resuspension upon administration, or in solution.
    [00083] In a preferred embodiment of the seventh aspect, a method for treating an individual with mucopolysaccharidosis type IIIA, with nucleotide sequences, gene constructs, viral vector particles, expression vectors, or the pharmaceutical compositions of the invention. The schemes and dosage for administering the nucleotide sequences, gene constructs, vectors, expression vectors, or pharmaceutical compositions according to the present invention can be determined according to known dosage protocols of the art. In a preferred embodiment, the nucleotide sequences, gene constructs, viral vector particles, expression vectors or pharmaceutical compositions according to the present invention are administered once.
    [00084] In a further embodiment, a pharmaceutical composition for a gene therapy treatment of MPS consists of the parenteral administration of an expression vector comprising a nucleotide sequence with 90% sequence identity to SEQ ID NO: 1.
    [00085] In another further embodiment, a viral vector, comprising the CAG promoter and a nucleotide sequence with 95% sequence identity to SEQ ID NO: 1 is used for gene therapy in the treatment of a lysosomal storage disease ( LSD) by intramuscular injection.
    [00086] In yet another further embodiment, an AAV vector of serotype 1, comprising the CAG promoter and a nucleotide sequence with 87% sequence identity to SEQ ID NO: 1 is used as a medicine to treat an MPS, being administered by intravenously.
    [00087] In a further embodiment, a pharmaceutical composition comprising a nucleotide sequence with 98% sequence identity to SEQ ID NO: 1, as well as a ubiquitous promoter, to treat a disease is administered parenterally.
    [00088] Having described the invention in general terms, the same will become more readily understood with reference to the following examples, which are presented as an illustration, not intending to limit the present invention. GENERAL PROCEDURES 1. Recombinant AAV Vectors
    [00089] The AAV vectors described here were constructed by triple transfection. The materials needed to make the vectors were: HEK293 cells (E1 gene expression), a helper plasmid that provides adenovirus function, a helper plasmid that provides the AAV rep genes of serotype 2 and cap genes of the desired serotype ( ie AAV1, AAV2, AAV5, AAV7, AAV8, AAV9) and finally the support plasmid with ITRs and the construct of interest.
    [00090] To generate AAV sulfamidase expression vectors, the murine sulfamidase cDNA was cloned into an AAV support plasmid, under the control of the ubiquitous hybrid CAG promoter or the hepato-specific hAAT promoter.
    [00091] The vectors (viral vector particles) were generated by virus-free help transfection of HEK293 cells, using three plasmids with modifications. See Matsushita T, et al., Gene Ther. 1998; 5: 938 - 945 and Wright J, et al, Mol. Ther. 2005; 12: 171 - 178. Cells were grown to 70% confluence in roller bottles (RB) (Corning, Corning, NY, US) in DMEM (Dulbecco's Modified Eagle's Essential Medium) supplemented with 10% FBS (Fetus Bovine Serum) and then co-transfected with: 1) a plasmid carrying the expression cassette flanked by the viral ITRs (described above); 2) a helper plasmid carrying AAV rep2 and the corresponding capsule (cap1 and cap9 genes; and 3) a plasmid carrying the helper functions of adenovirus. Vectors were purified by two consecutive cesium chloride gradients using either a standard protocol or an optimized protocol as described previously. See Ayuso E, et al., Gene Ther. 2010; 17: 503 - 510. Vectors were dialyzed against PBS, filtered, titrated by qPCR (Quantitative Polymerase Chain Reaction) and stored at -80°C until use. The. Construction of pAAV-CAG-mu-SFMD-WPRE
    [00092] Murine sulfamidase cDNA was used as starting material (Clone ID: D330015N16; Riken, Saitama, JP). cDNA was received into plasmid pFLCI-Sgsh. A high-fidelity PCR was performed to amplify the sulfamidase coding zone with primers that included Mlul restriction sites at both ends. The sequences of the respective sense and antisense primers were: SEQ ID NO: 5 (Fw) CTTACTTATGACGCGTATGCACTGCCCGGGAC TG and SEQ ID NO: 6 (Rv) TATCCTATCGACGCGTTCAGAGTTCATTGTGAAGCGG TC.
    [00093] The support plasmid pAAV-CAG-WPRE was generated previously and contained both the ITRs of the AAV2 genome, the CAG promoter, the WPRE element and the rabbit β-globin poly-A signal. The CAG promoter is a hybrid promoter, composed of the CMV premature/intermediate enhancer and the chicken β-actin promoter. This promoter manages to trigger a powerful ubiquitous expression.
    [00094] The woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is a hepadnavirus sequence widely used as a cis-active regulatory module in several types of plasmids or viral genetic vectors. When placed in the 3' untranslated region of gene transfer cassettes, WPRE stimulates transgene production by increasing both nuclear and cytoplasmic mRNA levels. See Zanta-Boussif M, et al., Gene Ther. 2009; 16: 605 - 619.
    The PCR-amplified sulfamide coding zone was cloned into the MluI restriction site of the AAV support plasmid pAAV-CAG-WPRE, and the resulting plasmid was designated pAAV-CAG-mu-SFMD-WPRE. See SEQ ID NO: 7. B. Construction of pAAV-CAG-mu-SFMD
    [00096] The WPRE element in plasmid pAAV-CAG-mu-SFMD-WPRE is flanked by two EcoRI restriction sites. To generate plasmid pAAV-CAG-mu-SFMD (DSM accession number 24818), plasmid pAAV-CAG-mu-SFMD-WPRE was digested with EcoRI to eliminate the WPRE sequence and subsequently religated. See SEQ ID NO: 8. ç. Construction of pAAV-CAG-co-hu-SFMD
    [00097] Plasmid pAAV-CAG-mu-SFMD was digested with Mlul and EcoRI in order to remove the murine sulfamidase coding region. Then, the codon-optimized human sulfamidase cDNA (co-hu-SFMD) was digested and cloned into the same restriction sites in order to generate plasmid pAAV-CAG-co-hu-SFMD (accession number DSM 24817) . See SEQ ID NO: 9. d. Construction of pAAV9-CAG-hu-SFMD
    [00098] Plasmid pAAV9-CAG-hu-SFMD was obtained by co-transfection of 293HEK cells with plasmid pAAV-CAG-co-hu-SFMD, a plasmid encoding the adenovirus help function and a plasmid encoding the AAV2 rep and AAV9 cap genes. and. Construction of pGG2-hAAT-mu-SFMD
    The murine sulfamidase coding region was extracted from plasmid pAAV-CAG-mu-SFMD-WPRE by digestion with Mlul. This region was then cloned into the Mlul site in the AAV support plasmid pGG2-hAAT to produce plasmid pGG2-hAAT-mu-SFMD (accession number DSM 24819). See SEQ ID NO: 10. f. Construction of pGG2-hAAT-co-hu-SFMD
    [000100] The codon-optimized human sulfamidase coding region was excised from plasmid pAAV-CAG-co-hu-SFMD (accession number DSM 24817) by digestion with Mlul-EcoRI. Plasmid pGG2-hAAT-mu-SFMD (accession number DSM 24819) was digested with Mlul to remove the mu-SFMD gene and then the codon-optimized human sulfamidase coding region was cloned into this site by ligation of blunt end. The resulting plasmid was called pGG2-hAAT-co-hu-SFMD. See SEQ ID NO: 11.
    [000101] Plasmid pGG2-hAAT-co-hu-SFMD contained both AAV2-ITRs and the hAAT promoter and the SV40-derived polyadenylation signal. g. Construction of pAAV9-hAAT-co-hu-SFMD and pAAV8-hAAT-co-hu SFMD.
    [000102] The vectors were generated by transfection of helper virus-free HEK293 cells, using three plasmids with modifications. See Matsushita, 1998, supra and Wright, 2005, supra. Cells were cultured to 70% confluency in roller bottles (RB) (Corning, Corning, NY, US) in DMEM supplemented with 10% FBS, and then co-transfected with: 1) a plasmid carrying the expression cassette flanked by viral ITRs (pGG2-hAAT-co-hu-SFMD); 2) a helper plasmid carrying AAV rep2 and the corresponding cap genes (cap8 or 9); and 3) a plasmid carrying the helper functions of adenovirus. Vectors were purified by two consecutive cesium chloride gradients using either a standard protocol or an optimized protocol as described above. See Ayuso, 2010, supra. Vectors were dialyzed against PBS, filtered, titrated by qPCR and stored at -80°C until use.
    [000103] Plasmid pGG2-hAAT-mu-SFMD contained both AAV2-ITRs, hAAT promoter and SV40-derived polyadenylation signal. The hAAT promoter is a hybrid promoter, composed of the 4 tandem repeats of the apolipoprotein E (HCR) hepatocyte control region enhancer and the human α-anti-trypsin promoter. Its expression is restricted to hepatocytes. See Mingozzi F, et al., J. Clin. Invest. 2003; 111: 1347 - 1356.
    [000104] The vectors of the present invention were constructed according to molecular biology techniques, well known in the art. See Brown T, "Gene Cloning" (Chapman & Hall, London, GB, 1995); Watson R, et al., "Recombinant DNA", 2nd Ed. (Scientific American Books, New York, NY, US, 1992); Alberts B, et al., "Molecular Biology of the Cell" (Garland Publishing Inc., New York, NY, US, 2008); Innis M, et al., Eds., “PCR Protocols. A Guide to Methods and Applications” (Academic Press Inc., San Diego, CA, US, 1990); Erlich H, Ed., “PCR Technology. Principles and Applications for DNA Amplification” (Stockton Press, New York, NY, US, 1989); Sambrook J, et al., “Molecular Cloning. A Laboratory Manual” (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US, 1989); Bishop T, et al., “Nucleic Acid and Protein Sequence. A Practical Approach” (IRL Press, Oxford, GB, 1987); Reznikoff W, Ed., "Maximizing Gene Expression" (Butterworths Publishers, Stoneham, MA, US, 1987); Davis L, et al., "Basic Methods in Molecular Biology" (Elsevier Science Publishing Co., New York, NY, US, 1986), Schleef M, Ed., "Plasmid for Therapy and Vaccination" (Wiley-VCH Verlag GmbH , Weinheim, DE, 2001). 2. Animals
    [000105] A colony of mice with congenital deficiency in sulfamidase C57BI/6 (MPSIIIA) was used. See Crawley A, et al., Brain Res. 2006; 1104: 1 - 17. MPSIIIA-affected mice and healthy mice in the control group were inhibited from heterozygous founders. The genotype was determined by PCR analysis on the genome DNA of tail clipped samples, which amplifies the sequence surrounding the mutation, and its subsequent digestion with the restriction enzyme MspAII, as previously described. See Bhattacharyya R, et al., Glycobiology 2001; 11: 99 - 103. Mice were fed ad libitum on a standard diet (Panlab, Barcelona, ES) and maintained on a 12-hour light-dark cycle (lights on at 9:00 am). 3. Sample administration and collection vector
    [000106] For intravenous administration of AAV vectors, a total dose of 1012 vector genomes of the appropriate vector was injected into 2-month-old MPSIIIA animals via the tail vein. For intramuscular injection, 2-month-old animals suffering from MPSIIIA were anesthetized with a mixture of ketamine (100 mg/kg) and xylacine (10 mg/kg), having a total dose of 1012 AAV vector genomes appropriate been injected into 6 muscles of the animals' hind limbs (quadriceps, gastrocnemius and tibialis anterior of both paws). At 10 months of age, mice were anesthetized and then transcardially perfused with 10 ml PBS to completely free blood from the tissues. All brain and various somatic tissues (including liver, spleen, pancreas, kidney, lung, heart, skeletal muscle and testes) were collected and frozen in liquid nitrogen and stored at -80°C, or immersed in formalin for further histological analysis . 4. RNA analysis
    [000107] Total RNA was obtained from skeletal muscle and liver samples using TriPure Isolation Reagent (Roche Diagnostics, Barcelona, ES) and analyzed by Northern blot technique. The clots were hybridized with a murine sulfamidase probe, radiolabeled with 32P-dCTP by random primer with the Ready-to-Go DNA Labeling Beads kit (Amersham Biosciences, Piscataway, NJ, US). 5. Sulfamidase activity and glycosaminoglycan quantification
    [000108] Liver, skeletal muscle and brain samples were sonicated in water, and the sulfamidase activity was analyzed in supernatants with a fluorogenic substrate derived from 4-methylumbelliferone (Moscerdam Substrates, Oegstgeest, NL), as described above. See Karpova E, et al., J. Inherit. Metab. Dis. 1996; 19: 278 - 285. Sulfamidase activity levels were normalized against the total amount of protein and quantified using Bradford protein analysis (Bio-Rad, Hercules, CA, US).
    [000109] For the quantification of glycosaminoglycan (GAG), tissue samples were weighed, which were then digested with proteinase K and the extracts clarified by centrifugation and filtration. GAG levels in tissue extracts and urine were determined using a Blyscan sulfated glycosaminoglycan kit (Biocolor, Carrickfergus, County Antrim, GB) with chondroitin 4-sulfate as standard. Tissue GAG levels were normalized to wet tissue weight and in urine to creatinine concentration, measured with a specific kit (Horiba ABX, Irvine, CA, US). 6. Histological analysis
    [000110] Tissues were fixed for 12 - 24 hours in formalin, embedded in paraffin and sectioned, followed by heat-induced epitope retrieval (citrate buffer, pH 6). For the immunohistochemical detection of LAMP1, paraffin sections were incubated overnight at 4°C with rat anti-LAMP1 antibody (1D4B; Santa Cruz Biotechnology, Santa Cruz, CA, US), diluted to a ratio of 1:100 and then incubated with biotinylated rabbit anti-mouse antibody (Dako, Glostrup, DK) at a ratio of 1:300. The LAMP1 signal was amplified by incubating the sections with the ABC-Peroxidase staining kit (Thermo Scientific , Waltham, MA, US), at 1:100, and visualized using 3,3-diaminobenzidine (Sigma-Aldrich, St. Louis, MO, US) as the chromogen. Bright field images were obtained with an optical microscope (Eclipse E800; Nikon, Tokyo, JP). For the immunostaining of parvalbumin and calbindin, paraffin sections were incubated overnight at 4°C with rabbit anti-calbindin D28k (Swant, Marly, CH) diluted 1: 2000, or with anti- rabbit parvalbumin (Swant, Marly, CH) diluted 1:100. Samples were then incubated with biotinylated goat anti-rabbit IgG (Vector Labs., Burlingame, CA, US), and then with streptavidin -Alexa 488 (1:100, Molecular Probes, Invitrogen, Carlsbad, CA, US); the nuclei were stained with TOPRO-3. Images were obtained with a confocal microscope (Leica Microsystems, Heidelberg, DE).
    [000111] For LAMP1 and Mac2 dual immunostaining, sections were first incubated overnight at 4°C with rat anti-LAMP1 antibody at a ratio of 1:100 and then with biotinylated rabbit anti-mouse antibody , at a ratio of 1:300, followed by an incubation with streptavidin-Alexa 488 (1:300). The sections were then incubated with rabbit anti-Mac2 at a ratio of 1:50, and then with biotinylated goat anti-rabbit at a ratio of 1:300, followed by incubation with streptavidin-Alexa 568 (1:300; Molecular Probes, Invitrogen, Carlsbad, CA, US). Finally, the nuclei were stained with Hoechst (1:100; Sigma-Aldrich, St. Louis, MO, US). 7. Western clot analysis
    [000112] The cerebellum halves were homogenized in protein lysis buffer. Ten micrograms of protein were run on a 10% (wt/vol) SDS-PAGE, transferred to polyvinylidene difluoride membranes and analyzed overnight at 4°C with primary antibodies against calbindin (Swant, Marly, CH) and α-tubulin (Abeam, Cambridge, MA, US). Detection was performed using horseradish peroxidase labeled swine anti-rabbit antibody (Dako, Glostrup, DK) and ECL Plus Western clot detection reagent (Amersham Biosciences, Piscataway, NJ, US). 8. Microscopic analysis of transmission electrons
    [000113] The mice were sacrificed by an overdose of isoflurane (Isofluo, Labs. Esteve, Barcelona, ES), and they were perfused, via the inferior vena cava, with 1 ml of 2.5% glutaraldehyde and paraformaldehyde at 2%. A small portion (approximately 1mm3) of the lateral lobe of the liver and the culmen of the cerebellum were sectioned and incubated for 2 hours at 4 °C in the same fixative. After washing in cold cacodylate buffer, the specimens were postfixed in 1% osmium tetroxide, stained with aqueous uranyl acetate, and then dehydrated through a growing battery of ethanol, and embedded in epoxy resin. The ultrathin sections (600 - 800 A) of the resin blocks were stained using lead citrate and examined in a transmission electron microscope (H-7000; Hitachi, Tokyo, JP). 9. Statistical analysis
    [000114] All results are expressed as mean ± SEM. Statistical comparisons were made using either a t-test or a one-way analysis of variance (ANOVA). Statistical significance was considered in the case of P < 0.05. EXAMPLES
    [000115] Example 1:
    [000116] Intramuscular administration of AAV1-CAG-mu-SFMD-WPRE
    A total dose of 1012 vector genomes of the AAV1-CAG-mu-SFMD-WPRE vector was injected into 6 hind limb muscles (quadriceps, gastrocnemius and tibialis anterior of both hind legs) of male and female mice. 2 months of age, with MPSIIIA.
    [000118] Eight months after administration, the injected muscles had high levels of vector-derived sulfamidase expression and activity, but very low levels of sulfamidase activity in serum (6 - 7% of control mice) were observed. suggested a low efficiency of skeletal muscle secretion. See Figures 1A and 1B. Furthermore, a very low but significant expression of vector-derived sulfamidase was observed in the liver of these mice, thus indicating that, at the time of injection, the vector left skeletal muscle into the circulation and was translated in the liver. Even with the low levels of sulfamidase activity achieved in the circulation, a correction of the accumulation of GAG in the liver was observed, as well as a significant reduction in some somatic tissues (spleen, heart, pancreas), but not in others (kidney, lung). See Figure 1C. No reduction in brain GAG accumulation was achieved. Example 2:
    [000119] Intramuscular Administration of AAV8-CAG-mu-SFMD-WPRE
    [000120] A total dose of 1012 vector genomes of the AAV8-CAG-mu-SFMD-WPRE vector was injected into 6 hind limb muscles (quadriceps, gastrocnemius and tibialis anterior of both hind legs) of male and female mice. 2 months of age, with MPSIIIA.
    [000121] Eight months after administration, the injected muscles had similar levels of sulfamidase activity to the healthy control animal. See Figure 2A. Low levels of sulfamidase activity were observed in serum (10 - 15% of control mice). See Figure 2B. A vector escape to the liver was also observed, even at levels higher than those of mice treated with intramuscular AAV1. See Example 1. A correction of GAG accumulation in liver and spleen was observed, as well as a greater reduction in other somatic tissues (heart, pancreas, urinary bladder), but kidney and lungs remained largely uncorrected. See Figure 2C. No reduction in brain GAG accumulation was achieved. Example 3:
    [000122] Intravenous administration of AAV8-CAG-mu-SFMD-WPRE
    [000123] A total dose of 1012 vector genomes of the AAV8-CAG-mu-SFMD-WPRE vector was injected into 2 month old mice with MPSIIIA via the tail vein.
    [000124] Eight months after administration, treated males had liver sulfamidase activity at levels similar to control mice, but 4 times lower in females. See Figure 3A. Accordingly, circulating sulfamidase activity was high in males (levels similar to control mice), and lower in females (25% of control mice). See Figure 3B. Elevated circulating sulfamidase levels were able to correct the accumulation of GAG in the liver, heart, spleen, pancreas and urinary bladder, and significantly reduced these levels in the lungs but not in the kidney. See Figure 3C for quantification of GAG in liver. No reduction in brain GAG accumulation was observed. Example 4:
    [000125] Intravenous Administration of AAV8-hAAT-mu-SFMD
    A total dose of 1012 vector genomes of the AAV8-hAAT-mu-SFMD vector was injected into 2 month old mice with MPSIIIA via the tail vein.
    [000127] Eight months after administration, the treated males had a level of sulfamidase activity in the liver 500% higher than in the control animals. In females, the level of sulfamidase in the liver reached the same level as in control animals. See Figure 4A. Circulating sulfamidase activity was consistently higher in males than females (500% in males vs. 160% in females). See Figure 4B. These supraphysiological levels of circulating sulfamidase were able to correct the accumulation of GAG in some somatic organs, including the kidney. See Figure 4C for the quantification of GAG in the liver.
    [000128] Treated males had low levels of sulfamidase activity and a reduced accumulation of GAG in the brain. See Figures 5A and B. Purkinje cells from the cerebellum of treated males had fewer electron-dense inclusions when examined by electron microscopy. See Figure 5C. Intravenous treatment with the vector AAV8-hAAT-mu-SFMD (“iv-AAV8-hAAT-mu-SFMD”) achieved correction of the somatic pathology, but only improved the neurodegeneration characteristic of mice with MPSIIIA.
    [000129] The ultrastructure of the cortex was analyzed by transmission electron microscopy. No distinct differences were noted in the ultrastructure of occipital cortex neurons from treated and untreated individuals with MPSIIIA. A clear enlargement of the lysosomal compartment was observed in the perineuronal glial cells of the untreated MPSIIIA mice, which was practically absent in the treated animals. See Figure 10. These results suggest that sustained and elevated circulating sulfamidase activity prevents neuronal degeneration in individuals with MPSIIIA.
    [000130] By 17 months of age, all untreated males with MPSIIIA had died, while 100% of males treated with iv-AAV8-hAAT-mu-SFMD were still alive (median survival = 14.2 ± 0.5 vs 18 .8 ± 0.9 months, for untreated and treated males with MPSIIIA, respectively, p = 0.001). This improvement was not evident in the female group, in which both treated and untreated subjects had similar survival rates (mean survival = 13.1 ± 0.5 vs. 13.9 ± 1.2 months for females with untreated and treated MPSIIIA, respectively, p = 0.467). This result is consistent with the lower levels of sulfamidase activity measured in serum and brain and with a lower degree of GAG reduction observed in female animals. See Figure 11.
    [000131] The longer survival of males with MPSIIIA treated with iv-AAV8-hAAT-mu-SFMD also demonstrated the therapeutic potential of sustained supraphysiological levels of sulfamidase in the circulation, achieved by gene transfer directed to the liver. Treatment with iv-AAV8-hAAT-mu-SFMD extended the life span of male mice with MPSIIIA. See Figure 11. Example 5:
    [000132] Intravenous administration of AAV9-CAG-mu-SFMD
    A total dose of 1012 vector genomes of the AAV9-CAG-mu-SFMD vector was injected into 2 month old mice with MPSIIIA via the tail vein.
    [000134] Both males and females treated showed high levels of sulfamidase in the circulation (500% of control levels in males and 150% in females), an efficacy that corrected all somatic tissues in both genders. Furthermore, and given the high efficiency of AAV serotype 9 brain transduction, significant sulfamidase activity was observed in the brain of animals of both genders, which effectively corrected the accumulation of GAG in all areas of the brain. See Figures 6A and 6B. Neuroinflammation (astrogliosis and microgliosis), characteristic of MPSIIIA, was completely normalized in mice treated with AAV9. Furthermore, mice treated with AAV9 performed better in the Rotarod test than untreated animals. See Figure 6C.
    [000135] Intravenous treatment with the vector AAV9-CAG-mu-SFMD ("iv-AAV9-CAG-mu-SFMD") extended the lifespan of animals with MPSIIIA. See Figure 12. By 17 months of age, all untreated males with MPSIIIA had died, while 100% of males treated with iv-AAV9-CAG-mu-SFMD were still alive at 20 months of age (p < 0.001 and p = 0.037 for males with MPSIIIA treated versus untreated, respectively). See Figure 12. The female group demonstrated a similar but less significant improvement (p = 0.063 and p = 0.057, respectively for treated females versus untreated females). This result is consistent with the lower levels of sulfamidase activity measured in the serum of female animals after treatment with iv-AAV9-CAG-mu-SFMD. Example 6:
    [000136] Intracisternal Administration of AAV9-CAG-mu-SFMD
    [000137] A total dose of 5 x 1010 vector genomes of the AAV9-CAG-mu-SFMD vector was injected into the cisterna magna of 2-month-old animals, anesthetized, with MPSIIIA, in a total volume of 5 μl.
    [000138] Three months after administration, complete correction of GAG accumulation in the whole brain of treated animals was achieved. See Figure 8. Vector-derived sulfamidase expression was also found in the liver of treated animals, suggesting that, after intracisternal administration, some vectors reach the circulation and are metabolized in the liver. According to this result, the accumulation of GAG was also normalized in the liver.
    [000139] The intracisternal administration of the vector AAV9-CAG-mu-SFMD ("ic-AAV9-CAG-mu-SFMD") extended the lifespan of animals with MPSIIIA. See Figure 12. By 17 months of age, all untreated males with MPSIIIA had died, while 100% of males treated with ic-AAV9-CAG-mu-SFMD were still alive at 20 months of age (p < 0.001 and p = 0.037 , respectively for males with MPSIIIA treated versus untreated). See Figure 12. The female group demonstrated a similar but less significant improvement (p = 0.063 and p = 0.057, respectively for females with MPSIIIA treated versus untreated). This result is consistent with the lower levels of sulfamidase activity measured in the serum of female animals after treatment with ic-AAV9-CAG-mu-SFMD. Example 7:
    [000140] Intravenous administration of AAV9-CAG-co-hu-SFMD (codon optimized human sulfamidase)
    [000141] The human sulfamidase codon usage has been optimized in order to reduce the vector-administered dose of the vector. The object of this approach was to stabilize the sulfamidase mRNA and increase its translation, thus favoring a higher production of sulfamidase by the dose of the same vector.
    Viral genomes 1012 (vg) of the AAV9-CAG-hu-co-SFMD vector were administered intravenously to 2-month-old mice with MPSIIIA, via the tail vein. At least a 3-fold increase in the level of sufamidase in the liver was obtained compared to the non-optimized gene. See Figure 9. Example 8:
    [000143] Intravenous administration of AAV9-hAAT-co-hu-SFMD
    Following the same procedure as described in example 7, two month old mice suffering from MPSIIIA were treated with 1012 vg of AAV9-hAAT-co-hu-SFMD vector intravenously via the tail vein. The sulfamidase level was measured in the same way as for example 7. The results demonstrate a substantial increase over the non-optimized gene. Example 9:
    [000145] Intracisternal administration of different AAV-CAG-GFP-WPRE serotypes
    [000146] To assess the brain tropism of the different AAV serotypes, when administered in the cerebrospinal fluid, 5 x 1010 vector genomes of the AAV1, AAV2, AAV5, AAV7, AAV8 and AAV9 vectors, carrying the GFP reporter gene, were administered intracisternally (CAG-GFP-WPRE construction) in mice with MPSIIIA.
    [000147] Significant transduction of cells in the Pox bridges was achieved by all serotypes, with the highest and lowest rates of efficacy achieved respectively by AAV9 and AAV1. In the cerebellum, the reporter signal was mostly located in axons identified morphologically as mossy fibers, and in particular with AAV1 and AAV9, but also with the other serotypes, with the exception of AAV8, in Purkinje neurons. Greater differences in the efficiency of gene transfer between serotypes were observed in distant regions of the brain. Many cells were translated into the cerebral cortex, olfactory bulb and hippocampus in the AAV9-injected group and, to a lesser extent, in the AAV7 group, whereas no GFP-positive cell bodies were observed with the AAV1, AAV2, AAV5 or AAV8 serotypes in these areas. In the hypothalamus, the AAV9 serotype efficiently translated neurons, and the AAV1 serotype led to the dispersion of a few GFP+ cells. It was possible to observe occasional GFP-positive axons in the whole brain of all groups, eventually projected from infected neurons near the cisterna magna. AAV9 vectors demonstrated the highest transduction efficiency among the different serotypes. See Figure 7. Example 10:
    [000148] Scalability of intracisternal administration of AAV9-CAG-co-hu-SFMD for clinical use
    [000149] As a first step towards a potential clinical application of intracisternal AAV9 administration, it was evaluated whether the transduction pattern observed in mice would be maintained in an animal with a more relevant brain size. For this, 1.5 x 1012 vg/kg of AAV9-CAG-GFP-WPRE were administered in the great cistern of Beagle dogs. In total, 4 dogs were injected; in two of the animals (dogs numbers 1 and 4) a pump was used to perfuse the viral vector solution, with a flow similar to the rate of formation of CFS (1 ml/10 minutes); in the other two (dogs numbers 2 and 3) the vector was perfused in a few seconds. Figure 13 shows the immunological detection of GFP in samples from dog number 1. A strong titration was observed in the regions close to the cisterna magna, such as the medulla oblongata, the pons of varolio and the hypothalamus. See Figure 13b, c and d. In the cerebellum, despite being close to the injection point, only a few isolated Purkinje cells were translated, while in the hippocampus, a region away from the cistern, there was an effective transduction of the dentate fascia. See Figure 13 i and j. Virus distribution through the CSF allowed the transduction of areas distant from the injection site, such as the rhinencephalon and the frontal, parietal and occipital cortex, where the more superficial areas demonstrated greater transduction. See Figure 13e, h and f. Finally, the vector also reached the spinal cord and the GFP signal was detected in the ventral motor neurons and astrocytes of nearby ganglia. See Figure 13a. Semi-quantitative comparison of GFP location in all four dogs suggested that the perfusion rate of the viral solution did not significantly influence the efficacy or distribution of the AAV9 vector. See Table 1.
    [000150] Finally, similarly to the observations made in mice after intracisternal administration of AAV9, GFP was also detected in the liver of Beagle dogs where an average of 3.7% of hepatocytes was translated. See Figure 14. These results suggested a systemic distribution of the AAV9 vector after intracisternal administration.


    [000151] Table 1. Semi-quantitative analysis and brain transduction analysis after ic administration of AAV9-GFP vectors in healthy beagle dogs. Several images of each brain area were counted by three independent observers, with the mean being represented. Semi-quantitative criteria were as follows: ( + ) less than 10 GFP-positive cells/10X microscopic field; ( + + ) 10-30 GFP-positive cells/10X microscopic field; ( + + + ) 30-60 GFP-positive cells/10X microscopic field and ( + + + + ) more than 60 GFP-positive cells/10X microscopic field. N.D. not determined. Example 11:
    [000152] Functional efficacy of codon-optimized human sulfamidase (co-hu-SFMD)
    [000153] Expression cassettes including a codon optimized version of the human sulfamidase cDNA sequence (co-hu-SFMD) were designed and obtained. Codon optimization was performed to increase the efficiency of SFMD protein production in man using the most abundant tRNAs for the species and also taking into account their specific translation profile. Mice were used for experimental purposes, due to their similarity to humans and the predictive ability of the mouse animal model.
    [000154] To ensure that this sequence leads to the production of active sulfamidase, male mice with MPSIIIA were injected intravenously with 1x1012 vg of an AAV9 vector, in which co-hu-SFMD was expressed under the control of the ubiquitous CAG promoter . The sulfamidase activity in the serum of these mice reached levels similar to those of healthy wild-type animals, which were maintained throughout the study period (2 months). See Figure 15a. This continuous sulfamidase activity led to normalization of the GAG content in the liver of these animals, similar to what was observed with the murine transgene administered by AAV9. See Figure 15b.
    [000155] All publications mentioned above are fully incorporated into this document for consultation.
    [000156] While the invention presented has been described in some detail, aiming at better clarity and understanding, any expert in the field will consider, after reading this invention, that various changes in form and content may be introduced, without departing from the true scope of the invention and the appended claims.
    权利要求:
    Claims (10)
    [0001]
    1. "GENETIC CONSTRUCTION" characterized in that it is an adeno-associated expression vector, comprising an artificial nucleotide sequence characterized in that it is SEQ ID NO: 1 coding for the protein SEQ ID NO: 2.
    [0002]
    2. "GENETIC CONSTRUCTION" according to claim 1, characterized in that the adeno-associated vector serotype is 1,2, 5, 7, 8 or 9.
    [0003]
    3. "GENETIC CONSTRUCTION" according to claim 2, characterized in that it comprises a CAG promoter operably linked to SEQ ID NO: 1.
    [0004]
    4. "GENETIC CONSTRUCTION" according to claim 3, characterized in that it is an adeno-associated vector of serotype 9 (AAV9) which comprises a CAG promoter operably linked to SEQ ID NO: 1 (co-hu-SFMD), wherein said genetic construct is designated as AAV9-CAG-co-hu-SFMD.
    [0005]
    5. "PLASMIC" characterized in that the accession number DSM 24817 which contains the genetic construct according to claim 1 (co-hu-SFMD) and a CAG promoter, wherein the plasmid is designated as pAAV-CAG-co-hu -SFMD.
    [0006]
    6. "GENETIC CONSTRUCTION" according to claim 1, characterized in that it comprises an hAAT promoter operably linked to SEQ ID NO: 1.
    [0007]
    7. "A PLASMID" characterized in that it contains the genetic construct according to claim 1 (co-hu-SFMD) operably linked to the hAAT promoter, wherein the plasmid is designated as pAAV-hAAT-co-hu-SFMD.
    [0008]
    8. "USE OF THE GENETIC CONSTRUCTION" according to any of claims 1 to 4 and 6; the plasmid according to any of claims 5 or 7, characterized in that it is for the production of a medicament for the treatment of muco-polysaccharidoses
    [0009]
    9. "USE OF THE GENETIC CONSTRUCTION" according to claim 8, characterized in that it is for the production of a drug for the treatment of mucopolysaccharidoses type IIIA or Sanfilippo syndrome.
    [0010]
    10. "METHOD FOR PRODUCING THE EXPRESSION VECTORS" according to claim 1 characterized in that it comprises the steps of i) Providing a first vector comprising SEQ ID NO: 1 interposed between a first terminal repeat of the AAV and a second terminal repeat from AAV, a CAG or hAAT promoter operably linked to SEQ ID NO: 1; a second vector comprising a REP AAV gene and a CAP AAV gene; and a third vector comprising the adenovirus helper function; ii) Co-transfecting competent HEK293 cells with phase i vectors; iii) Culture the transfected cells from stage ii); and iv) Purify the expression vectors from the stage iii) culture.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112012031067B1|2021-05-04|isolated sequence, isolated nucleotide sequence, genetic construct, expression vectors, plasmid vectors paav-cag-co-hu-sfmd and paav-haat-co-hu-sfmd, pharmaceutical composition and method for its manufacture, method to produce the expression vectors, isolated cell, and method for the treatment of type iiia mucopolysaccharidosis
    JP6634073B2|2020-01-22|Adeno-associated virus vector for treatment of lysosomal storage disease
    EP3303576B1|2020-02-12|Adenoassociated virus vectors for the treatment of mucopolysaccharidoses
    EP3519569B1|2020-12-02|Adenoassociated virus vectors for the treatment of mucopolysaccharidoses
    WO2005120581A2|2005-12-22|Gene therapy for neurometabolic disorders
    IL279054D0|2021-01-31|Adenoassociated virus vectors for the treatment of mucopolysaccharidoses type iv a
    BR112020010735A2|2020-11-10|gene therapy for mucopolysaccharidosis iii a
    US20150191527A1|2015-07-09|Methods of treating alzheimer&#39;s disease with apo a-1 milano
    同族专利:
    公开号 | 公开日
    ES2659031T3|2018-03-13|
    ME02940B|2018-04-20|
    US20130158104A1|2013-06-20|
    HRP20180146T1|2018-03-23|
    CN103037905B|2016-01-20|
    NZ603901A|2014-10-31|
    US9279132B2|2016-03-08|
    KR101952966B1|2019-02-28|
    SG186136A1|2013-01-30|
    RS57458B1|2018-09-28|
    SG10201504583XA|2015-07-30|
    JP2013531490A|2013-08-08|
    EP2394667A1|2011-12-14|
    AR081868A1|2012-10-24|
    RU2588667C2|2016-07-10|
    US20150104863A1|2015-04-16|
    EP2579900B1|2017-11-08|
    UA112841C2|2016-11-10|
    PL2579900T3|2018-04-30|
    EP2579900A1|2013-04-17|
    DK2579900T3|2018-01-29|
    TW201201842A|2012-01-16|
    CA2801639C|2019-05-28|
    CA2801639A1|2011-12-15|
    WO2011154520A1|2011-12-15|
    CN103037905A|2013-04-10|
    AU2011263697A1|2012-12-20|
    CY1119892T1|2018-06-27|
    LT2579900T|2018-02-26|
    NO2579900T3|2018-04-07|
    SI2579900T1|2018-04-30|
    KR20140019211A|2014-02-14|
    MX2012014372A|2013-01-22|
    IL223274D0|2013-02-03|
    MY172292A|2019-11-20|
    TWI547288B|2016-09-01|
    ZA201209103B|2013-08-28|
    RU2013100176A|2014-07-20|
    PT2579900T|2018-02-09|
    AU2011263697B2|2017-02-16|
    ES2388620A1|2012-10-17|
    IL223274A|2016-11-30|
    JP6066902B2|2017-01-25|
    US8999948B2|2015-04-07|
    ES2388620B1|2013-11-13|
    HUE038190T2|2018-09-28|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    EP1002091B1|1997-07-09|2012-02-29|Coridon Pty Limited|Nucleic acid sequence and method for selectively expressing a protein in a target cell or tissue|
    AU1775901A|1999-11-17|2001-05-30|Avigen, Inc.|Recombinant adeno-associated virus virions for the treatment of lysosomal disorders|
    US7351813B2|2000-06-20|2008-04-01|The Board Of Trustees Of The Leland Stanford Junior University|Liver-specific gene expression cassettes, and methods of use|
    GB0100889D0|2001-01-12|2001-02-21|Oxford Glycosciences Uk Ltd|Compounds|
    WO2003100031A2|2002-05-20|2003-12-04|Board Of Regents, The University Of Texas System|Methods and compositions for delivering enzymes and nucleic acid molecules to brain, bone, and other tissues|
    EP1578969B1|2002-11-08|2010-04-07|The University Of Queensland|A method for optimising gene expression using synonymous codon optimisation|
    AU2004210936C1|2003-02-11|2010-12-02|Shire Human Genetic Therapies, Inc.|Diagnosis and treatment of Multiple Sulfatase Deficiency and other using a Formylglycine Generating Enzyme |
    AU2008205410B2|2007-01-05|2013-10-10|Massachusetts Institute Of Technology|Compositions of and methods of using sulfatases from flavobacterium heparinum|
    CA2720097C|2007-04-09|2016-07-19|University Of Florida Research Foundation, Inc.|Raav vector compositions having tyrosine-modified capsid proteins and methods for use|US9309534B2|2010-07-12|2016-04-12|Universidad Autonoma De Barcelona|Gene therapy composition for use in diabetes treatment|
    EP2492347A1|2012-05-22|2012-08-29|Laboratorios Del. Dr. Esteve, S.A.|Methods for the production of vectors|
    EP2692868A1|2012-08-02|2014-02-05|Universitat Autònoma De Barcelona|Adeno-associated viralvectors useful for transducing adipose tissue|
    WO2014151341A1|2013-03-15|2014-09-25|The Trustees Of The University Of Pennsylvania|Compositions and methods for treating mpsi|
    WO2014186579A1|2013-05-15|2014-11-20|Regents Of The University Of Minnesota|Adeno-associated virus mediated gene transfer to the central nervous system|
    KR20160035596A|2013-07-26|2016-03-31|유니버시티 오브 아이오와 리써치 파운데이션|Methods and compositions for treating brain diseases|
    ES2687262T3|2014-04-01|2018-10-24|Swedish Orphan Biovitrum Ab |Modified sulfamidase and production thereof|
    CA2947468A1|2014-05-14|2015-11-19|Laboratorios Del Dr. Esteve S.A.|Adenoassociated virus vectors for the treatment of lysosomal storage disorders|
    CA2960912A1|2014-09-16|2016-03-24|Universitat Autonoma De Barcelona|Adeno-associated viral vectors for the gene therapy of metabolic diseases|
    GB201420139D0|2014-11-12|2014-12-24|Ucl Business Plc|Factor IX gene therapy|
    US11085055B2|2014-12-05|2021-08-10|Universitat Autonoma De Barcelona|Viral vectors for the treatment of diabetes|
    CA2967468A1|2014-12-16|2016-06-23|Board Of Regents Of The University Of Nebraska|Gene therapy for juvenile batten disease|
    ES2784264T3|2014-12-17|2020-09-23|Fundacion Para La Investig Medica Aplicada|Nucleic Acid Constructs and Gene Therapy Vectors for Use in the Treatment of Wilson's Disease and Other Conditions|
    JP6865167B2|2014-12-17|2021-04-28|フンダシオン パラ ラ インベスティガシオン メディカ アプリカダ|Nucleic acid constructs and gene therapy vectors for use in the treatment of Wilson's disease|
    US11033638B2|2015-01-07|2021-06-15|Universität Autonoma De Barcelona|Single-vector gene construct comprising insulin and glucokinase genes|
    SG11201707116QA|2015-03-10|2017-09-28|Univ Columbia|Recombinant glut1 adeno-associated viral vector constructs and related methods for restoring glut1 expression|
    MX2017014443A|2015-05-15|2018-08-01|Univ Minnesota|Adeno-associated for therapeutic delivery to central nervous system.|
    KR102200642B1|2015-11-05|2021-01-12|뱀부 테라퓨틱스 인코포레이티드|Modified Friedreich ataxia genes and vectors for gene therapy|
    CA3012195A1|2016-02-03|2017-08-10|The Trustees Of The University Of Pennsylvania|Gene therapy for treating mucopolysaccharidosis type i|
    JP2019518002A|2016-04-15|2019-06-27|ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア|Gene therapy to treat mucopolysaccharidosis type II|
    AU2017248659A1|2016-04-15|2018-10-18|The Trustees Of The University Of Pennsylvania|Gene therapy for treating hemophilia A|
    WO2018011572A1|2016-07-12|2018-01-18|The University Of Manchester|Gene therapy|
    AU2017313844A1|2016-08-19|2019-04-11|University Of Florida Research Foundation, Incorporated|Methods and compositions for treating conditions using recombinant self-complementary adeno-associated virus|
    EP3519569B1|2016-09-30|2020-12-02|Esteve Pharmaceuticals, S.A.|Adenoassociated virus vectors for the treatment of mucopolysaccharidoses|
    AU2018265869A1|2017-05-12|2019-11-21|The Children's Hospital Of Philadelphia|Sulfamidasevariants, vectors, compositions and methods and uses for treating mucopolysaccharidosis type IIIA |
    TWI722310B|2017-08-03|2021-03-21|美商航海家醫療公司|Compositions and methods for delivery of aav|
    CA3083416A1|2017-11-30|2019-06-06|The Trustees Of The University Of Pennsylvania|Gene therapy for mucopolysaccharidosis iii a|
    US10610606B2|2018-02-01|2020-04-07|Homology Medicines, Inc.|Adeno-associated virus compositions for PAH gene transfer and methods of use thereof|
    US20210230632A1|2018-05-15|2021-07-29|Voyager Therapeutics, Inc.|Compositions and methods for delivery of aav|
    US20210198691A1|2018-05-15|2021-07-01|Voyager Therapeutics, Inc.|Compositions and methods for the treatment of parkinson's disease|
    WO2019222444A2|2018-05-16|2019-11-21|Voyager Therapeutics, Inc.|Directed evolution|
    CN108728495A|2018-05-31|2018-11-02|深圳市免疫基因治疗研究院|A kind of Sanfilippo A syndromes slow virus carrier, slow virus and its preparation method and application|
    US10842885B2|2018-08-20|2020-11-24|Ucl Business Ltd|Factor IX encoding nucleotides|
    JP2022500066A|2018-09-28|2022-01-04|ボイジャー セラピューティクス インコーポレイテッドVoyager Therapeutics, Inc.|Frataxin expression construct with an engineered promoter and how to use it|
    WO2020077165A1|2018-10-12|2020-04-16|Voyager Therapeutics, Inc.|Compositions and methods for delivery of aav|
    WO2020127678A1|2018-12-20|2020-06-25|Esteve Pharmaceuticals, S.A.|Recombinant vectors for the long term treatment of mucchopolysacharidosis|
    CN113631225A|2019-01-18|2021-11-09|沃雅戈治疗公司|Methods and systems for producing AAV particles|
    TW202039856A|2019-03-28|2020-11-01|西班牙商艾斯提夫製藥股份有限公司|Methods for the manufacture of recombinant viral vectors|
    WO2021046155A1|2019-09-03|2021-03-11|Voyager Therapeutics, Inc.|Vectorized editing of nucleic acids to correct overt mutations|
    CN111718947A|2020-06-18|2020-09-29|舒泰神（北京）生物制药股份有限公司|Adeno-associated virus vector for treating type IIIA or IIIB mucopolysaccharidosis and use thereof|
    WO2022026410A2|2020-07-27|2022-02-03|Voyager Therapeutics, Inc|Compositions and methods for the treatment of niemann-pick type c1 disease|
    WO2022026409A1|2020-07-27|2022-02-03|Voyager Therapeutics, Inc.|Compositions and methods for the treatment of neurological disorders related to glucosylceramidase beta deficiency|
    法律状态:
    2018-01-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|
    2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2019-01-15| B25D| Requested change of name of applicant approved|Owner name: UNIVERSIDAD AUTONOMA DE BARCELONA (ES) ; ESTEVE PH Owner name: UNIVERSIDAD AUTONOMA DE BARCELONA (ES) ; ESTEVE PHARMACEUTICALS, S.A. (ES) |
    2019-01-29| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |
    2019-02-05| B25G| Requested change of headquarter approved|Owner name: UNIVERSIDAD AUTONOMA DE BARCELONA (ES) ; ESTEVE PH Owner name: UNIVERSIDAD AUTONOMA DE BARCELONA (ES) ; ESTEVE PHARMACEUTICALS, S.A. (ES) |
    2019-06-11| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|
    2019-11-26| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2020-05-26| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|
    2021-03-02| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2021-05-04| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 10/06/2011, OBSERVADAS AS CONDICOES LEGAIS. |
    优先权:
    申请号 | 申请日 | 专利标题
    EP20100382169|EP2394667A1|2010-06-10|2010-06-10|Vectors and sequences for the treatment of diseases|
    EP10382169.0|2010-06-10|
    PCT/EP2011/059678|WO2011154520A1|2010-06-10|2011-06-10|Vectors and sequences for the treatment of diseases|
    [返回顶部]